BLASTN 2.3.0+
Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.
Database: homo-mature.fasta
2,588 sequences; 55,870 total letters
Query= TACAGAACCCTTTTAAGAACTGTAAGCCTTGTGAGGTTCGGCAGGTGTTATTTTCCTCTTTGC
Length=63
***** No hits found *****
Lambda K H
1.33 0.621 1.12
Gapped
Lambda K H
1.28 0.460 0.850
Effective search space used: 1111300
Database: homo-mature.fasta
Posted date: Sep 23, 2016 6:16 PM
Number of letters in database: 55,870
Number of sequences in database: 2,588
Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5